Default

Molecular Genomics Core Facility

Boston, Massachusetts, US

The Molecular Genetics Core Facility (MGCF) is a non-profit core laboratory in the Program in Genomics and Genetics Division of Children’s Hospital Boston offering genomics services for academic research institutions. The majority of MGCF users are investigators from Children’s Hospital Boston and the surrounding Harvard affiliates, but the MGCF also serves laboratories throughout the entire United States. The MGCF is comprised of a compilation of smaller cores partially supported by private and federal funds. Funding is provided in part through The Intellectual and Developmental Disabilities Research Center, The Manton Center for Orphan Disease Research, The Wellstone Center for Muscular Dystrophy, and The Neuromuscular Disease Project of the Program in Genomics at Children’s Hospital Boston.

The overall objective of the MGCF is to provide a location where researchers can have access to high quality, low cost... Show more »

The Molecular Genetics Core Facility (MGCF) is a non-profit core laboratory in the Program in Genomics and Genetics Division of Children’s Hospital Boston offering genomics services for academic research institutions. The majority of MGCF users are investigators from Children’s Hospital Boston and the surrounding Harvard affiliates, but the MGCF also serves laboratories throughout the entire United States. The MGCF is comprised of a compilation of smaller cores partially supported by private and federal funds. Funding is provided in part through The Intellectual and Developmental Disabilities Research Center, The Manton Center for Orphan Disease Research, The Wellstone Center for Muscular Dystrophy, and The Neuromuscular Disease Project of the Program in Genomics at Children’s Hospital Boston.

The overall objective of the MGCF is to provide a location where researchers can have access to high quality, low cost genomic technology services and expertise in a timely, affordable manner. The services offered include DNA sequencing, Next-Gen sequencing, Affymetrix and Illumina whole-genome expression and genotyping microarray technology, microsatellite genotyping, high-throughput qPCR and SNP services on the Fluidigm Biomark System, multiplex SNP genotyping on the Sequenom MassARRAY, and sample extraction and banking. The MGCF also assists investigators with project design.

« Show less

Molecular Genomics Core Facility has not listed any services.

Ask A Question Find what you're looking for? If not, you can ask this lab a question:
Digital PCR
Starting at $15.00 per sample

Bio-Rad's QX200™ AutoDG™ Droplet Digital PCR System can be used to gather highly precise answers. Absolute quantification using digital PCR is achieved through partitioning the sample into nanoliter-sized droplets, which allow for thousands of discrete measurements per sample. As the success of the project is correlated to... Show more »

Bio-Rad's QX200™ AutoDG™ Droplet Digital PCR System can be used to gather highly precise answers. Absolute quantification using digital PCR is achieved through partitioning the sample into nanoliter-sized droplets, which allow for thousands of discrete measurements per sample. As the success of the project is correlated to quality of assay design, we would like primer design to be approved by Bio-Rad. Price listed is per sample, with an 8 sample minimum.

« Show less
SNP Microarray
Single nucleotide polymorphism microarray
Price on request

The Affymetrix Genome-Wide Human SNP Array 6.0 features 906,600 single nucleotide polymorphisms (SNPs) and 946,000 probes for the detection of copy number variation.AffyChip

Customers should check genomic DNA integrity and quantity by running gel and Nanodrop before submitting samples to the core. Also, Affymetrix chips must be... Show more »

The Affymetrix Genome-Wide Human SNP Array 6.0 features 906,600 single nucleotide polymorphisms (SNPs) and 946,000 probes for the detection of copy number variation.AffyChip

Customers should check genomic DNA integrity and quantity by running gel and Nanodrop before submitting samples to the core. Also, Affymetrix chips must be purchased and supplied to the Core by the user. Customers are provided with all the array files associated with their runs and data analysis/informatics options.

Price Chart:

Chip Type Service AssayType Species Core Affiliate(IDDRC) Price Internal(BCH,NON-IDDRC) Price External Price Industry Price
Affymetrix Human SNP 6.0 Array Full Service SNPs/CNV Human $300.00 $350.00 $370 $450
« Show less
Single Nucleotide Polymorphism (SNP) Genotyping
Price on request

The BioMark System developed by Fluidigm utilizes Biomark thousands of intertwining fluid control valves with interconnected channels within a silicon chip to properly combine reagents and samples into 1000s of individual reactors. With this technology the BioMark instrument is capable of running real-time quantitative PCR (qPCR),... Show more »

The BioMark System developed by Fluidigm utilizes Biomark thousands of intertwining fluid control valves with interconnected channels within a silicon chip to properly combine reagents and samples into 1000s of individual reactors. With this technology the BioMark instrument is capable of running real-time quantitative PCR (qPCR), SNP genotyping, and digital PCR assays in a high-throughput, low volume fluidics chip. The Molecular Genetics Core Facility has now adopted this technology to offer as a service for investigators.

For SNP analysis, there are two detection chemistry customers can choose from: TaqMan SNP assay from ABI and SNPtype assay from Fludigm. Samples and assays may be submitted for SNP genotyping on the Dynamic Array chips. These are available in two forms: 48 x 48 and 96 x 96. The 48 x 48 arrays enable testing of 48 samples against 48 assays (a total of 2304 reactions). The 96 x 96 arrays enable testing of 96 samples against 96 assays (a total of 9216 reactions). The price per run does not include assays. Customers should purchase assays directly from the vendors.

For human genomic sample, the core requires at least 10ul at 60ng/ul. gDNA preamplification can be performed if less than 10 ul at 60ng/ul were submitted. The sample requirement varies from species to species, depending on the genome size of species. Please consult with the core if you work with non-human sample.

Price Chart:

Service Core Affiliate(IDDRC) Internal(BCH,NON-IDDRC) External Industry
TaqMan/SNPtype Genotpying– 48×48 $550 $600 $660 $725
TaqMan/SNPtype Genotpying– 96×96 $825 $910 $1000 $1100
gDNA preamplification- 48 samples $65 $70 $75 $80
« Show less
Microsatellite Instability Testing
Price on request

The Genomic Mapping Facility of the MGCF is focused on providing quality microsatellite genotyping data using markers from the Applied Biosystems Human Linkage Mapping Set v2.5 MD10(Panels 1-28) or by custom markers provided by core users. Each marker consists of a fluorescent dye-labeled primer pair designed around a specific... Show more »

The Genomic Mapping Facility of the MGCF is focused on providing quality microsatellite genotyping data using markers from the Applied Biosystems Human Linkage Mapping Set v2.5 MD10(Panels 1-28) or by custom markers provided by core users. Each marker consists of a fluorescent dye-labeled primer pair designed around a specific microsatellite region. Microsatellites are di-, tri- or tetra-nucleotide repeats distributed throughout the genome. Because the number of repeats for each microsatellite marker has expanded and contracted throughout history, they are polymorphic in populations. A hypothetical sequence containing a -CA- dinucleotide repeat might look as follows:

CATGCACACACACATTAAC

allele genotype 5 (because it has 5 -CA- repeats)

CATGCACACACACACACATTAAC

allele genotype 7 (because it has 7 -CA- repeats)

The number of repeats in one’s maternal and paternal alleles of a given marker is likely to be different thereby allowing one to distinguish maternal and paternal alleles by size. The alleles for a specific microsatellite are amplified by PCR using genomic DNA from the subject, the markers for that microsatellite, and a cocktail of enzyme and buffers. PCR amplification of the microsatellite region will produce copies of the fragment from each allele present, the maternal and paternal alleles. The size of the fragment representing each allele can be determined by capillary electrophoresis and the fluorescent label from the marker.

Submitting Samples:

For singleplexed samples, each well should contain 500pg-1000pg of DNA. If multiplexing sample reactions in a single well, products must be labeled with separate fluorescent dyes, or have marker size ranges separated by at least 70 bp. All products must be at least 75 bp in length or smaller than 500 bp. When designing custom markers, use only the fluorescent dyes FAM (blue), VIC (green), NED (yellow), or PET (red). For 96-well plates, submit samples in semi-skirted, ABI 3730 compatible plates. For 384-well plate submissions, use the Thermo Scientific Diamond plates (catalog # AB-1111).

If shipping samples, carefully seal all plates or tubes and pad the package appropriately. Dried samples do not need to be sent frozen. Once properly packed, please send all shipments to:

Service Core Affiliate(IDDRC) Internal(BCH,NON-IDDRC) External Industry
Pre-run 96-well Plate $50 $75 $100 $150
Pre-run 384-well Plate $200/plate $300/plate $400 $500
« Show less
Biology
Price on request
Request a quote for more information about this service.
Biochemistry & Molecular Biology
Price on request
Request a quote for more information about this service.
Nucleic Acid Services
Price on request
Request a quote for more information about this service.
DNA Services
Price on request
Request a quote for more information about this service.
Genotyping Services
Price on request
Request a quote for more information about this service.
DNA Microarrays
Price on request
Request a quote for more information about this service.
PCR
Price on request
Request a quote for more information about this service.
2018-02-09 01:49:49 -1100

Net Promoter Score of 10 received for Microsatellite Instability Testing.

Additional Ratings: satisfaction with deliverable: 10, satisfaction with timeliness: 10.

Be the first to endorse Molecular Genomics Core Facility

Endorse this lab