1392414790789 c4ced60448b418b315255d1cab59730e

Bio Basic

Markham, Ontario, CA

Bio Basic Inc. is a privately owned dynamic biotechnology company. The company was founded in 1990 in Toronto, Canada. From 1990 to 1995, Bio Basic Inc.’s primary focus has been in the field of biochemicals. Starting in 1995, Bio Basic Inc. has begun manufacturing various Life Science Products. Throughout the past years, the company has developed rapidly and served as a one-stop-shop to our customers in the life sciences field. To date, Bio Basic Inc. has approximately 600 employees, seven laboratories, three factory buildings, 40 international distributors and over 10,000 customers worldwide.

Bio Basic Inc. is committed to innovation and excellence. In an effort to achieve this, Bio Basic Inc. has continuously directed efforts in R & D and improving the quality of our products. Bio Basic Inc. is proud to offer a breath of products and services to customers worldwide. Several of our product lines such as,... Show more »

Bio Basic Inc. is a privately owned dynamic biotechnology company. The company was founded in 1990 in Toronto, Canada. From 1990 to 1995, Bio Basic Inc.’s primary focus has been in the field of biochemicals. Starting in 1995, Bio Basic Inc. has begun manufacturing various Life Science Products. Throughout the past years, the company has developed rapidly and served as a one-stop-shop to our customers in the life sciences field. To date, Bio Basic Inc. has approximately 600 employees, seven laboratories, three factory buildings, 40 international distributors and over 10,000 customers worldwide.

Bio Basic Inc. is committed to innovation and excellence. In an effort to achieve this, Bio Basic Inc. has continuously directed efforts in R & D and improving the quality of our products. Bio Basic Inc. is proud to offer a breath of products and services to customers worldwide. Several of our product lines such as, Molecular Biology Kits, Biochemicals, Synthetic Genes and Synthetic Oligos have already shown dominant market presence and have been widely recognized by customers worldwide.

« Show less

Bio Basic has not listed any services.

Gene Synthesis
Starting at $0.23 per base

• $0.23 USD per base pair for all standard sequences less than 2kb (promotion price).

• Minimum order of $120.00 is required.

• The option of a discount on a long term contract is also available.

• Free Optimization.

• Fully cloned and 100% sequence verified.

• You will receive 2-4ug of gene in pUC57 vector, as... Show more »

• $0.23 USD per base pair for all standard sequences less than 2kb (promotion price).

• Minimum order of $120.00 is required.

• The option of a discount on a long term contract is also available.

• Free Optimization.

• Fully cloned and 100% sequence verified.

• You will receive 2-4ug of gene in pUC57 vector, as well as accompanying data-files.

• Further discount for large projects and long term contracts is available. Discount rates are based on total number of base pairs of your gene order.

• Shipping is $35.00.

« Show less
Oligonucleotide Synthesis
Starting at $0.16 per base

Pricing:

Starting at $0.16/base for HAP Purification (2OD yield). (promotion price)

Features:

. Highest Purity at Lowest Price
. Specializing in HAP* (High Affinity Purification) and PAGE Purification
. Worldwide Services
. High Capacity: 5000 primers/day
. One of the Largest and the Most Experienced Suppliers
.... Show more »

Pricing:

Starting at $0.16/base for HAP Purification (2OD yield). (promotion price)

Features:

. Highest Purity at Lowest Price
. Specializing in HAP* (High Affinity Purification) and PAGE Purification
. Worldwide Services
. High Capacity: 5000 primers/day
. One of the Largest and the Most Experienced Suppliers
. Fast Services: Synthesis Completed within 24 or 36 Hours (for HAP* or PAGE)
. All modified base oligos are purified by HPLC (WAVE system)
. Highest QC and Quality Guaranteed
. Wide Range Product Lines

High Affinity Purification (HAP) is a patented, novel purification method for custom oligos developed by Bio Basic Inc. DMT-ON-Oligo in the crude oligo mixture is first selectively absorbed on a high affinity resin in HAP column while incomplete oligos pass through. Final oligo is produced by removing the protection group of DMT under mild acidic conditions. HAP method provides two major advantages, high purity superior to De-Salted method (>98%), and low cost comparable to PAGE or HPLC methods. Oligos produced by the HAP method has such high purity that they can be directly used for any downstream experiments such as PCR, DNA Sequencing, Gene Synthesis, and Mutagenesis. At present, the most economic method to produce oligos is the De-Salted method, which however, yields products poor in purity. For example, the purity of 20-mer, 40-mer and 60-mer is approximately 68%, 45% and 30% respectively. This is calculated based on the 4 steps in DNA synthesis: De-DMT, Coupling, Oxidation and Capping. The average yield of each cycle is about 98%. The purity of 20-mer is therefore (0.98)20-1 = 68%; of 40-mer = (0.98)40-1 = 45%; and of 60-mer = (0.98)60-1 = 30%. Most laboratories use De-Salted oligos despite of their inferior purity because higher quality oligos produced by alternative methods such as PAGE, HPLC, and OPC are too costly. HAP presents the perfect alternative for high purity oligos at lowest prices. In fact, price is even lower than those of De-Salted method in some cases.

When you request an estimate for your order:
. Please indicate scales, purification method, 5' end or 3' end modification
. To guarantee quality, we do not carry De-salted oligos. HAP is a superior purification scale than Desalt.

« Show less
Peptide Synthesis
Price on request

Key Features:

• ISO9001:2000 certified
• Ten years of experience in Peptide Synthesis.
• From short peptides to long peptides ( >100 amino acids).
• From the regular peptides to all kinds of modified peptides.
• From mgs to kilograms.
• GMP standard peptides are available.
• All peptides are delivered with HPLC and... Show more »

Key Features:

• ISO9001:2000 certified
• Ten years of experience in Peptide Synthesis.
• From short peptides to long peptides ( >100 amino acids).
• From the regular peptides to all kinds of modified peptides.
• From mgs to kilograms.
• GMP standard peptides are available.
• All peptides are delivered with HPLC and Mass Spectroscopy data.
• Low prices GUARANTEED. Price matching and beating services available.

Specifications:

• All custom peptides are supplied with strict analytical specifications, which include HPLC and MS analysis.
• Most custom peptides can be delivered within 2-3 weeks. The delivery time may vary depending on the peptide length and nature of the sequences, as well as modifications.
• All information is treated with strict confidentiality. If required, we are pleased to sign a client confidentiality agreement before receiving your compound structure.

« Show less
Polyclonal Antibody Production
Price on request

Bio Basic’s Polyclonal Antibody Service is designed to supply you with custom, affinity purified pAbs that are guaranteed to detect your antigen of choice using ELISA (titer > 1:50,000) and Dot Blot assays. We can also extend our service to guarantee pAbs that will work in your assay of choice for the ultimate peace of mind. ... Show more »

Bio Basic’s Polyclonal Antibody Service is designed to supply you with custom, affinity purified pAbs that are guaranteed to detect your antigen of choice using ELISA (titer > 1:50,000) and Dot Blot assays. We can also extend our service to guarantee pAbs that will work in your assay of choice for the ultimate peace of mind. Our peptide-supplied and protein-supplied packages are equipped to handle any antigen—our experienced scientists will conjugate your peptide and subject your protein to rigorous quality control prior to immunization to optimize serum antibody yield.
Explore Bio Basic’s custom polyclonal antibody packages today and begin a partnership that will guarantee you results!

« Show less
Protein Purification
Price on request

We have three expression systems:

  1. E.Coli Expression System
  2. Baculovirus Expression System
  3. Mammalian Expression System

  4. For E.Coli expression projects, we have a standard pricing and they come in guaranteed packages of 1mg, 5mg and 15mg of purified protein.

  5. or 3. In the case of the Baculovirus or Mammalian... Show more »

We have three expression systems:

  1. E.Coli Expression System
  2. Baculovirus Expression System
  3. Mammalian Expression System

  4. For E.Coli expression projects, we have a standard pricing and they come in guaranteed packages of 1mg, 5mg and 15mg of purified protein.

  5. or 3. In the case of the Baculovirus or Mammalian expression projects, we start with a pilot study (please inquire about pricing) in order to analyze whether the expression would be high or low. Then, based on the results of the pilot study, we determine pricing for the subsequent full-length project.

After the pilot study, you can choose whether to continue with the project, should you be satisfied with the price and pilot study results.

Projects can either be initiated from gene synthesis, or you can simply provide us with the constructs that you would like to express.

At the end of the project, we deliver all of the products we guarantee (amount of protein or study results).

« Show less
Sanger Sequencing
Starting at $3.50 per sample

Bio Basic ADVANTAGES:

• Repeat Sequencing – Other service providers will usually only provide a single run.
• Courtesy Gel Analysis – Our team will perform a courtesy gel analysis.
• Positive controls – Included to ensure proper sequencing chemistry and procedures are carried out.
• No strict guidelines for sample layout –... Show more »

Bio Basic ADVANTAGES:

• Repeat Sequencing – Other service providers will usually only provide a single run.
• Courtesy Gel Analysis – Our team will perform a courtesy gel analysis.
• Positive controls – Included to ensure proper sequencing chemistry and procedures are carried out.
• No strict guidelines for sample layout – We accept samples in many formats and arrangements. We will not refuse an order due to orientation and will gladly work with you to sort things out. Of course we would appreciate it if you would arrange your samples in a certain order (column by column or row by row).
• No penalties – We understand that not everything works out, samples may be compromised during transit. We do not charge for reactions we do not perform.
• Very competitive pricing (pricing listed is promotional pricing).
• Free shipping for more than 100 reactions.
• Samples are accepted as bacterial colonies, glycerol stocks, pelleted cultures and crude PCR products.

STANDARD PRICING:

Bacterial/Plasmids /PCR: 1-10 samples $5.00
10-99 samples $4.80
100-500 samples $4.50
> 500 samples Please Inquire

Free Shipping for more than 100 samples run.

The following primers are available free of charge:

Universal Primer Sequence
M13 Forward (-20) GTAAAACGACGGCCAGT
M13 Reverse (-26) CAGGAAACAGCTATGAC
pGEX 3' CCGGGAGCTGCATGTGTCAGAGG
pGEX 5' GGGCTGGCAAGCCACGTTTGGTG
SP6 ATTTAGGTGACACTATA
T3 ATTAACCCTCACTAAAG
T7 (long) AATACGACTCACTATAGGG
T7 (short) AATACGACTCACTATAG
T7 terminator GCTAGTTATTGCTCAGCGGT

« Show less
Protein Services
Price on request
Request a quote for more information about this service.
Chemistry and Materials
Price on request
Request a quote for more information about this service.
Synthetic Chemistry
Price on request
Request a quote for more information about this service.
DNA Sequencing
Price on request
Request a quote for more information about this service.
Therapeutic Monoclonal Antibody (mAb) Development
Price on request
Request a quote for more information about this service.
Biochemistry & Molecular Biology
Price on request
Request a quote for more information about this service.
Antibody Services
Price on request
Request a quote for more information about this service.
Protein Purification and Quantification
Price on request
Request a quote for more information about this service.
Nucleic Acid Services
Price on request
Request a quote for more information about this service.
Biology
Price on request
Request a quote for more information about this service.
DNA
Price on request
Request a quote for more information about this service.
DNA Synthesis
Price on request
Request a quote for more information about this service.
Ask A Question Find what you're looking for? If not, you can ask this lab a question:

Bio Basic has not received any ratings.

Be the first to endorse Bio Basic

Endorse this lab