3pmvoxpotnohfcjo1rod bio basic logo v1b no back

Bio Basic

No Reviews Yet
2 Orders Completed
Markham, Ontario, CA

About Bio Basic

At Bio Basic we believe laboratory services and consumables can, and should, be affordable. We directly manufacture genes, oligonucleotides, extraction kits, PCR reagents, and many more research essentials while offering the most affordable rates in the industry, without compromising their... Show more »

At Bio Basic we believe laboratory services and consumables can, and should, be affordable. We directly manufacture genes, oligonucleotides, extraction kits, PCR reagents, and many more research essentials while offering the most affordable rates in the industry, without compromising their quality.

The advancement of scientific research involves a long and arduous journey through many stages. It is our belief that supporting the initial stage of scientific research, or basic research, is essential to the success of that process.

Basic scientific research suffers the most when the costs of scientific goods and services rise and that is why it is our mission to be facilitators of basic scientific research. Supporting basic research now enables the success of applied research in the future.

Show less

Our Services (17)


ic

Gene Synthesis

Starting at $0.09 per base

Our reputation as gene synthesis specialists is consistently emphasized as our competitors fail to deliver large (5kb to 25kb+) and complex genes, whereas we have over a 95% completion rate on even the most complex of genes. Any company which relies purely on silicon well-based platforms is limited to the construction of small... Show more »

Our reputation as gene synthesis specialists is consistently emphasized as our competitors fail to deliver large (5kb to 25kb+) and complex genes, whereas we have over a 95% completion rate on even the most complex of genes. Any company which relies purely on silicon well-based platforms is limited to the construction of small and simple genes, thereby limiting their ability to work on a significant portion (up to 50%) of gene projects.

• From $0.09 USD per base pair for your first order with us

• Minimum price per gene is $99 

• Free Optimization.

• Fully cloned and 100% sequence verified.

• 2-4ug of gene in vector, up to 10ug free upon request.

• Shipping is $25-45.00 depending on location.

Trust represents the largest obstacle when looking for new and reliable gene synthesis partners, which is why we are offering our renowned gene synthesis services at USD $0.09/bp your first order. Please inquire at gene[a.t]biobasic[d.o.t]com (1-800-313-7224 ext. 322) with your sequence.

Show less

ic

Oligonucleotide Synthesis

Starting at $0.16 per base

Pricing:

Starting at $0.16/base for HAP Purification (2OD yield). (promotion price)

Features:

. Highest Purity at Lowest Price
. Specializing in HAP* (High Affinity Purification) and PAGE Purification
. Worldwide Services
. High Capacity: 5000 primers/day
. One of the Largest and the Most Experienced Suppliers
.... Show more »

Pricing:

Starting at $0.16/base for HAP Purification (2OD yield). (promotion price)

Features:

. Highest Purity at Lowest Price
. Specializing in HAP* (High Affinity Purification) and PAGE Purification
. Worldwide Services
. High Capacity: 5000 primers/day
. One of the Largest and the Most Experienced Suppliers
. Fast Services: Synthesis Completed within 24 or 36 Hours (for HAP* or PAGE)
. All modified base oligos are purified by HPLC (WAVE system)
. Highest QC and Quality Guaranteed
. Wide Range Product Lines

High Affinity Purification (HAP) is a patented, novel purification method for custom oligos developed by Bio Basic Inc. DMT-ON-Oligo in the crude oligo mixture is first selectively absorbed on a high affinity resin in HAP column while incomplete oligos pass through. Final oligo is produced by removing the protection group of DMT under mild acidic conditions. HAP method provides two major advantages, high purity superior to De-Salted method (>98%), and low cost comparable to PAGE or HPLC methods. Oligos produced by the HAP method has such high purity that they can be directly used for any downstream experiments such as PCR, DNA Sequencing, Gene Synthesis, and Mutagenesis. At present, the most economic method to produce oligos is the De-Salted method, which however, yields products poor in purity. For example, the purity of 20-mer, 40-mer and 60-mer is approximately 68%, 45% and 30% respectively. This is calculated based on the 4 steps in DNA synthesis: De-DMT, Coupling, Oxidation and Capping. The average yield of each cycle is about 98%. The purity of 20-mer is therefore (0.98)20-1 = 68%; of 40-mer = (0.98)40-1 = 45%; and of 60-mer = (0.98)60-1 = 30%. Most laboratories use De-Salted oligos despite of their inferior purity because higher quality oligos produced by alternative methods such as PAGE, HPLC, and OPC are too costly. HAP presents the perfect alternative for high purity oligos at lowest prices. In fact, price is even lower than those of De-Salted method in some cases.

When you request an estimate for your order:
. Please indicate scales, purification method, 5' end or 3' end modification
. To guarantee quality, we do not carry De-salted oligos. HAP is a superior purification scale than Desalt.

Show less

ic

Peptide Synthesis

Price on request

Key Features:

• ISO9001:2000 certified
• Ten years of experience in Peptide Synthesis.
• From short peptides to long peptides ( >100 amino acids).
• From the regular peptides to all kinds of modified peptides.
• From mgs to kilograms.
• GMP standard peptides are available.
• All peptides are delivered with HPLC and Mass... Show more »

Key Features:

• ISO9001:2000 certified
• Ten years of experience in Peptide Synthesis.
• From short peptides to long peptides ( >100 amino acids).
• From the regular peptides to all kinds of modified peptides.
• From mgs to kilograms.
• GMP standard peptides are available.
• All peptides are delivered with HPLC and Mass Spectroscopy data.
• Low prices GUARANTEED. Price matching and beating services available.

Specifications:

• All custom peptides are supplied with strict analytical specifications, which include HPLC and MS analysis.
• Most custom peptides can be delivered within 2-3 weeks. The delivery time may vary depending on the peptide length and nature of the sequences, as well as modifications.
• All information is treated with strict confidentiality. If required, we are pleased to sign a client confidentiality agreement before receiving your compound structure.

Show less

ic

Polyclonal Antibody Production

Price on request

Bio Basic’s Polyclonal Antibody Service is designed to supply you with custom, affinity purified pAbs that are guaranteed to detect your antigen of choice using ELISA (titer > 1:50,000) and Dot Blot assays. We can also extend our service to guarantee pAbs that will work in your assay of choice for the ultimate peace of mind. Our... Show more »

Bio Basic’s Polyclonal Antibody Service is designed to supply you with custom, affinity purified pAbs that are guaranteed to detect your antigen of choice using ELISA (titer > 1:50,000) and Dot Blot assays. We can also extend our service to guarantee pAbs that will work in your assay of choice for the ultimate peace of mind. Our peptide-supplied and protein-supplied packages are equipped to handle any antigen—our experienced scientists will conjugate your peptide and subject your protein to rigorous quality control prior to immunization to optimize serum antibody yield.
Explore Bio Basic’s custom polyclonal antibody packages today and begin a partnership that will guarantee you results!

Show less

ic

Protein Purification

Price on request

We have three expression systems:

  1. E.Coli Expression System

  2. Baculovirus Expression System

  3. Mammalian Expression System

  4. For E.Coli expression projects, we have a standard pricing and they come in guaranteed packages of 1mg, 5mg and 15mg of purified protein.

  5. or 3. In the case of the Baculovirus or Mammalian... Show more »

We have three expression systems:

  1. E.Coli Expression System

  2. Baculovirus Expression System

  3. Mammalian Expression System

  4. For E.Coli expression projects, we have a standard pricing and they come in guaranteed packages of 1mg, 5mg and 15mg of purified protein.

  5. or 3. In the case of the Baculovirus or Mammalian expression projects, we start with a pilot study (please inquire about pricing) in order to analyze whether the expression would be high or low. Then, based on the results of the pilot study, we determine pricing for the subsequent full-length project.

After the pilot study, you can choose whether to continue with the project, should you be satisfied with the price and pilot study results.

Projects can either be initiated from gene synthesis, or you can simply provide us with the constructs that you would like to express.

At the end of the project, we deliver all of the products we guarantee (amount of protein or study results).

Show less

ic

Sanger Sequencing

Starting at $3.50 per sample

Bio Basic ADVANTAGES:

• Repeat Sequencing – Other service providers will usually only provide a single run.
• Courtesy Gel Analysis – Our team will perform a courtesy gel analysis.
• Positive controls – Included to ensure proper sequencing chemistry and procedures are carried out.
• No strict guidelines for sample layout –... Show more »

Bio Basic ADVANTAGES:

• Repeat Sequencing – Other service providers will usually only provide a single run.
• Courtesy Gel Analysis – Our team will perform a courtesy gel analysis.
• Positive controls – Included to ensure proper sequencing chemistry and procedures are carried out.
• No strict guidelines for sample layout – We accept samples in many formats and arrangements. We will not refuse an order due to orientation and will gladly work with you to sort things out. Of course we would appreciate it if you would arrange your samples in a certain order (column by column or row by row).
• No penalties – We understand that not everything works out, samples may be compromised during transit. We do not charge for reactions we do not perform.
• Very competitive pricing (pricing listed is promotional pricing).
• Free shipping for more than 100 reactions.
• Samples are accepted as bacterial colonies, glycerol stocks, pelleted cultures and crude PCR products.

STANDARD PRICING:

Bacterial/Plasmids /PCR: 1-10 samples $5.00
10-99 samples $4.80
100-500 samples $4.50
> 500 samples Please Inquire

Free Shipping for more than 100 samples run.

The following primers are available free of charge:

Universal Primer Sequence
M13 Forward (-20) GTAAAACGACGGCCAGT
M13 Reverse (-26) CAGGAAACAGCTATGAC
pGEX 3' CCGGGAGCTGCATGTGTCAGAGG
pGEX 5' GGGCTGGCAAGCCACGTTTGGTG
SP6 ATTTAGGTGACACTATA
T3 ATTAACCCTCACTAAAG
T7 (long) AATACGACTCACTATAGGG
T7 (short) AATACGACTCACTATAG
T7 terminator GCTAGTTATTGCTCAGCGGT

Show less

ic

Protein Services

Price on request
Request a quote for more information about this service.

ic

Chemistry and Materials

Price on request
Request a quote for more information about this service.

ic

Synthetic Chemistry

Price on request
Request a quote for more information about this service.

ic

DNA Sequencing

Price on request
Request a quote for more information about this service.

ic

Therapeutic Monoclonal Antibody (mAb) Development

Price on request
Request a quote for more information about this service.

ic

Biochemistry & Molecular Biology

Price on request
Request a quote for more information about this service.

ic

Antibody Services

Price on request
Request a quote for more information about this service.

ic

Nucleic Acid Services

Price on request
Request a quote for more information about this service.

ic

Biology

Price on request
Request a quote for more information about this service.

ic

DNA Services

Price on request
Request a quote for more information about this service.

ic

DNA Synthesis and Probe Development

Price on request
Request a quote for more information about this service.

Not finding what you're looking for?

Get info on this provider's capabilities without requesting a quote.
BB

Bio Basic

Manager

FileType/PDF Created with Sketch. Genes-and-Proteins-Bio-Basic-PH-V5-0.09-OL.pdf

Click to Download

Bio Basic has not received any reviews.

Bio Basic has not received any endorsements.